Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

CPSF3 Gene

protein-coding   GIFtS: 61
GCID: GC02P009514

cleavage and polyadenylation specific factor 3, 73kDa

(Previous names: cleavage and polyadenylation specific factor 3, 73kD subunit...)
 Explore 4 diseases affiliated with
CPSF3 via
MalaCards
our new
 Human Malady Compendium 
Biological research products
for CPSF3    

Aliases
for CPSF3 gene

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, and/or 10fRNAdb)
About This Section
Aliases
Cleavage And Polyadenylation Specific Factor 3, 73kDa1 2     Cleavage And Polyadenylation Specificity Factor Subunit 32
CPSF731 2 3     EC 3.1.27.-3
CPSF-731 2     Cleavage And Polyadenylation Specificity Factor 73 KDa Subunit3
MRNA 3'-End-Processing Endonuclease CPSF-732 3     CPSF 73 KDa Subunit3
YSH11     EC 3.1.278
Cleavage And Polyadenylation Specific Factor 3, 73kD Subunit1     

External Ids:    HGNC: 23261   Entrez Gene: 516922   Ensembl: ENSG000001192037   OMIM: 6060295   UniProtKB: Q9UKF63   

Export aliases for CPSF3 gene to outside databases

Previous GC identifers: GC02P009347 GC02P009615 GC02P009585


Summaries
for CPSF3 gene

(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section
Entrez Gene summary for CPSF3:
This gene encodes a member of the metallo-beta-lactamase family. The encoded protein is a 73kDa subunit of the cleavage
and polyadenylation specificity factor and functions as an endonuclease that recognizes the pre-mRNA 3'-cleavage site
AAUAAA prior to polyadenylation. It also cleaves after the pre-mRNA sequence ACCCA during histone 3'-end pre-mRNA
processing. (provided by RefSeq, Oct 2012)

UniProtKB/Swiss-Prot: CPSF3_HUMAN, Q9UKF6
Function: Component of the cleavage and polyadenylation specificity factor (CPSF) complex that play a key role in
pre-mRNA 3'-end formation, recognizing the AAUAAA signal sequence and interacting with poly(A) polymerase and other
factors to bring about cleavage and poly(A) addition. Has endonuclease activity, and functions as mRNA
3'-end-processing endonuclease. Also involved in the histone 3'-end pre-mRNA processing. U7 snRNP-dependent protein
that induces both the 3'-endoribonucleolytic cleavage of histone pre-mRNAs and acts as a 5' to 3' exonuclease for
degrading the subsequent downstream cleavage product (DCP) of mature histone mRNAs. Cleavage occurs after the
5'-ACCCA-3' sequence in the histone pre-mRNA leaving a 3'hydroxyl group on the upstream fragment containing the stem
loop (SL) and 5' phosphate on the downstream cleavage product (DCP) starting with CU nucleotides. The U7-dependent 5'
to 3' exonuclease activity is processive and degrades the DCP RNA substrate even after complete removal of the
U7-binding site. Binds to the downstream cleavage product (DCP) of histone pre-mRNAs and the cleaved DCP RNA substrate
in a U7 snRNP dependent manner

Gene Wiki entry for CPSF3


Genomic Views
for CPSF3 gene

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000002.11  NC_018913.1  NT_005334.16  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the CPSF3 gene promoter:
         p53   MAZR   Egr-1   Olf-1   HNF-1A   POU2F1   POU2F1a   HNF-1   Pax-4a   RSRFC4   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmid: CPSF3 promoter sequence
   Search SABiosciences Chromatin IP Primers for CPSF3

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat CPSF3


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 2p25.1   Ensembl cytogenetic band:  2p25.1   HGNC cytogenetic band: 2p25.1

CPSF3 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
CPSF3 gene location

GeneLoc information about chromosome 2         GeneLoc Exon Structure

GeneLoc location for GC02P009514:  view genomic region     (about GC identifiers)

Start:
 9,563,697 bp from pter      End:
 9,613,230 bp from pter
Size:
 49,534 bases      Orientation:
 plus strand

Proteins
for CPSF3 gene

(According to 1UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to 2PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section
UniProtKB/Swiss-Prot: CPSF3_HUMAN, Q9UKF6 (See protein sequence)
Recommended Name: Cleavage and polyadenylation specificity factor subunit 3  
Size: 684 amino acids; 77486 Da
Cofactor: Binds 2 zinc ions per subunit
Subunit: Component of the cleavage and polyadenylation specificity factor (CPSF) complex, composed of CPSF1, CPSF2,
CPSF3, CPSF4 and FIP1L1. Interacts with CPSF2, CSTF2 and SYMPK. Interacts with TUT1; the interaction is direct and
mediates the recruitment of the CPSF complex on the 3'UTR of pre-mRNAs. Interacts with WDR33
Subcellular location: Nucleus
2 PDB 3D structures from and Proteopedia for CPSF3:
2I7T (3D)        2I7V (3D)    
Secondary accessions: O14769 Q53RS2 Q96F36

Explore the universe of human proteins at neXtProt for CPSF3: NX_Q9UKF6

Post-translational modifications:

  • Sumoylated on Lys-462, Lys-465 and Lys-545, preferentially by SUMO31
  • View modification sites using PhosphoSitePlus2
  • View neXtProt modification sites for NX_Q9UKF6

    • 4/14 DME Specific Peptides for CPSF3 (Q9UKF6) (see all 14)
     LILDEYW  SHFHLDH  FDDIGPSV  TKAIYRWL 

    CPSF3 Protein expression data from MOPED and PaxDb:    About this image 
    Estimated protein expression log10 (pmol).

    REFSEQ proteins: NP_057291.1  
    ENSEMBL proteins: 
     ENSP00000238112   ENSP00000419744   ENSP00000418957  
    Reactome Protein details: Q9UKF6
    Human Recombinant Protein Products: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Protein: CPSF3
    OriGene Protein Over-expression Lysate: CPSF3
    OriGene Custom Protein Services for CPSF3 
    GenScript Custom Purified and Recombinant Proteins Services for CPSF3
    Novus Biologicals CPSF3 Proteins
    Novus Biologicals CPSF3 Lysates
    Browse Sino Biological Recombinant Proteins
    Browse ProSpec Recombinant Proteins
    Uscn Proteins for CPSF3

    Gene Ontology (GO): 3 cellular component terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005654nucleoplasm TAS--
    GO:0005847mRNA cleavage and polyadenylation specificity factor complex IDA18305108
    GO:0030529ribonucleoprotein complex IEA--


    CPSF3 for ontologies           About GeneDecksing



    CPSF3 Antibody Products: 
    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    OriGene Antibodies: CPSF3
    OriGene Custom Antibody Services for CPSF3 
    GenScript Custom Superior Antibodies Services for CPSF3
    Novus Biologicals CPSF3 Antibodies
    Abcam antibodies for CPSF3 
    Uscn Antibodies for CPSF3
    Search ThermoFisher Antibodies for CPSF3

    Assay Products for CPSF3: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Immunoassay Development
    Browse OriGene Fluorogenic Cell Assay Kits
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for CPSF3
    Browse Enzo Life Sciences for kits & assays
    Uscn ELISAs and CLIAs for CPSF3

    Protein Domains /
    Families
    for CPSF3 gene

    (According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section
    CPSF3 for domains           About GeneDecksing

    4 InterPro domains/families:
     IPR011108 RMMBL
     IPR001279 Beta-lactamas-like
     IPR022712 Beta_Casp
     IPR021718 CPSF73-100_C

    Graphical View of Domain Structure for InterPro Entry Q9UKF6

    ProtoNet protein and cluster: Q9UKF6

    1 Blocks protein family: IPB011108 RNA-metabolising metallo-beta-lactamase

    UniProtKB/Swiss-Prot: CPSF3_HUMAN, Q9UKF6
    Similarity: Belongs to the metallo-beta-lactamase superfamily. RNA-metabolizing metallo-beta-lactamase-like family.
    CPSF3 subfamily


    Function
    for CPSF3 gene

    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
    About This Section
    Function Summary:

         UniProtKB/Swiss-Prot: CPSF3_HUMAN, Q9UKF6
    Function: Component of the cleavage and polyadenylation specificity factor (CPSF) complex that play a key role in
    pre-mRNA 3'-end formation, recognizing the AAUAAA signal sequence and interacting with poly(A) polymerase and other
    factors to bring about cleavage and poly(A) addition. Has endonuclease activity, and functions as mRNA
    3'-end-processing endonuclease. Also involved in the histone 3'-end pre-mRNA processing. U7 snRNP-dependent protein
    that induces both the 3'-endoribonucleolytic cleavage of histone pre-mRNAs and acts as a 5' to 3' exonuclease for
    degrading the subsequent downstream cleavage product (DCP) of mature histone mRNAs. Cleavage occurs after the
    5'-ACCCA-3' sequence in the histone pre-mRNA leaving a 3'hydroxyl group on the upstream fragment containing the stem
    loop (SL) and 5' phosphate on the downstream cleavage product (DCP) starting with CU nucleotides. The U7-dependent 5'
    to 3' exonuclease activity is processive and degrades the DCP RNA substrate even after complete removal of the
    U7-binding site. Binds to the downstream cleavage product (DCP) of histone pre-mRNAs and the cleaved DCP RNA substrate
    in a U7 snRNP dependent manner

    Enzyme Numbers (IUBMB): EC 3.1.272 EC 3.1.27.-1

    miRNA
    Products:            		 OriGene 3'-UTR Clone: CPSF3
    Browse MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat CPSF3
    1 QIAGEN miScript miRNA Assays for microRNA that regulate CPSF3:
    hsa-miR-3919
    Browse SwitchGear 3'UTR luciferase reporter plasmids
    Inhib. RNA
    Products:            		Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for CPSF3 (see all 7)
    OriGene shRNA RFP: CPSF3
    OriGene siRNA: CPSF3
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat CPSF3

    Gene Editing
    Products:    		DNA2.0 Custom Protein Engineering Service for CPSF3

    Clone
    Products:             		Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for CPSF3 (see all 3)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for CPSF3
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: CPSF3 (NM_016207)
    Sino Biological Human cDNA Clone for CPSF3
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for CPSF3
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat CPSF3 

    Cell Line
    Products:             		GenScript Custom overexpressing Cell Line Services for CPSF3
    Search LifeMap BioReagents cell lines for CPSF3

    In Situ Assay
    Products:       
         		Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for CPSF3

    Gene Ontology (GO): 5 molecular function terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0003723RNA binding ISS--
    GO:0004521endoribonuclease activity ISS--
    GO:0005515protein binding IPI18288197
    GO:00084095'-3' exonuclease activity ISS--
    GO:0046872metal ion binding IEA--


    CPSF3 for ontologies           About GeneDecksing


    3 GenomeRNAi human phenotypes for CPSF3:
     Decreased NANOG protein expres  Decreased OCT4 protein express  Decreased POU5F1-GFP protein e 

    Animal Models:
         1 MGI mutant phenotype (inferred from 1 allele) (MGI details for Cpsf3):
     mortality/aging 

    CPSF3 for phenotypes           About GeneDecksing


    Pathways & Interactions
    for CPSF3 gene

    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
    About This Section

    Unified GeneCards pathways - 5/8 super-pathways (see all 8) About this table 
    See pathways by source

    Super-pathwaycontained gene-specific pathways
    1RNA Polymerase II Transcription Termination
    		RNA Polymerase II Transcription Termination1.00
    		Post-Elongation Processing of Intron-Containing pre-mRNA0.79
    		Post-Elongation Processing of the Transcript1.00
    		mRNA 3'-end processing0.79
    		Cleavage of Growing Transcript in the Termination Region 1.00
    2mRNA Splicing - Major Pathway
    		mRNA Splicing1.00
    		mRNA Processing0.82
    		mRNA Splicing - Major Pathway1.00
    		mRNA processing0.48
    		Processing of Capped Intron-Containing Pre-mRNA0.96
    3Post-Elongation Processing of Intronless pre-mRNA
    		Processing of Capped Intronless Pre-mRNA1.00
    		Processing of Intronless Pre-mRNAs0.61
    		Post-Elongation Processing of Intronless pre-mRNA1.00
    4Transport of Mature mRNA Derived from an Intronless Transcript
    		Transport of Mature mRNA Derived from an Intronless Transcript1.00
    		Transport of Mature mRNAs Derived from Intronless Transcripts0.89
    5Transcription
    		Transcription1.00
    		RNA Polymerase II Transcription0.69

    Pathway sources
    See GeneCards unified pathways
    Show all pathways


    1 BioSystems Pathway for CPSF3 
        mRNA processing

    5/18        Reactome Pathways for CPSF3 (see all 18)
        Transport of Mature Transcript to Cytoplasm
    mRNA Splicing
    Transport of Mature mRNA Derived from an Intronless Transcript
    RNA Polymerase II Transcription
    Cleavage of Growing Transcript in the Termination Region


    1         Kegg Pathway  (Kegg details for CPSF3):
        mRNA surveillance pathway


    CPSF3 for pathways           About GeneDecksing

    Interactions:

        SABiosciences Gene Network CentralTM Interacting Genes and Proteins Network for CPSF3

    STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

    5/823 Interacting proteins for CPSF3 (Q9UKF62, 3 ENSP000002381124) via UniProtKB, MINT, STRING, and/or I2D (see all 823)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    CPSF2Q9P2I02, ENSP000002988754MINT-6802591 MINT-8198073 MINT-6802527 MINT-7947479 MINT-7945693 MINT-6802510 MINT-6802560 MINT-6802545 MINT-8089129 MINT-6802610 STRING: ENSP00000298875
    PAPOLAP510032, 3, ENSP000002162774MINT-8198073 MINT-8201295 I2D: score=1 STRING: ENSP00000216277
    CLP1Q929892, 3, ENSP000003047044MINT-7945693 I2D: score=1 STRING: ENSP00000304704
    CSTF2P332402, ENSP000003620634MINT-6802591 MINT-6802527 MINT-6802510 MINT-6802560 MINT-6802545 MINT-8089129 STRING: ENSP00000362063
    SYMPKQ927972, ENSP000002459344MINT-8198073 MINT-7947479 MINT-7945693 MINT-6802510 MINT-6802610 STRING: ENSP00000245934
    About this table

    Gene Ontology (GO): 5/11 biological process terms (GO ID links to tree view) (see all 11):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0000398mRNA splicing, via spliceosome TAS--
    GO:0006366transcription from RNA polymerase II promoter TAS--
    GO:0006369termination of RNA polymerase II transcription TAS--
    GO:0006378mRNA polyadenylation TAS8929409
    GO:0006379mRNA cleavage TAS8929409


    CPSF3 for ontologies           About GeneDecksing



    Drugs & Compounds
    for CPSF3 gene

    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section

    CPSF3 for compounds           About GeneDecksing

    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for CPSF3
    2 Novoseek chemical compound relationships for CPSF3 gene    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    adenylate 69.5 38 8627681 (4), 15937220 (4), 1634525 (3), 14749727 (3) (see all 13)
    zinc 0 4 17128255 (3), 16115198 (1)

    Search CenterWatch for drugs/clinical trials and news about CPSF3 

    Transcripts
    for CPSF3 gene

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section
    REFSEQ mRNAs for CPSF3 gene: 
    NM_016207.3  

    Unigene Cluster for CPSF3:

    Cleavage and polyadenylation specific factor 3, 73kDa
    Hs.515972  [show with all ESTs]
    Unigene Representative Sequence: BC014106
    5 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000238112(uc010ewx.1 uc002qzo.1) ENST00000475482 ENST00000460593(uc002qzp.1)
    ENST00000489629 ENST00000489403

    miRNA
    Products:             		 OriGene 3'-UTR Clone: CPSF3
    Browse OriGene MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat CPSF3
    1 QIAGEN miScript miRNA Assays for microRNA that regulate CPSF3:
    hsa-miR-3919
    Browse SwitchGear 3'UTR luciferase reporter plasmids
    Inhib. RNA
    Products:             		Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for CPSF3 (see all 7)
    OriGene shRNA RFP: CPSF3
    OriGene siRNA: CPSF3
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat CPSF3
    Clone
    Products:             		 OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for CPSF3 (see all 3)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for CPSF3
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: CPSF3 (NM_016207)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for CPSF3
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat CPSF3 
    Primer
    Products:            		 OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for CPSF3
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat CPSF3
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat CPSF3
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat CPSF3

    Additional cDNA sequence: 

    AF017269.1 AF171877.1 AK025440.1 AK223487.1 BC011654.2 BC014106.1 BC020211.1 BC030988.1 
    BC043432.2 EF036508.1 

    20 DOTS entries:

    DT.95176661  DT.100792408  DT.121022117  DT.216213  DT.102829033  DT.121022169  DT.121022192  DT.95237872 
    DT.438707  DT.100792410  DT.101961422  DT.121022105  DT.121022237  DT.75105096  DT.121022167  DT.121022223 
    DT.121022259  DT.91755084  DT.95176663  DT.99951700 

    24/282 AceView cDNA sequences (see all 282):

    BM996158 BU542760 BC020211 CB528442 AI653500 AI795928 AF171877 CB135810 
    BQ013372 AL541009 CD251412 AW204437 AA635764 BM972592 BM909811 BF593455 
    AW207544 AI634675 BP376921 BQ227504 BM721106 BQ887831 BC014106 BQ653832 

    GeneLoc Exon Structure

    5/6 Alternative Splicing Database (ASD) splice patterns (SP) for CPSF3 (see all 6)    About this scheme

    ExUns: 1 ^ 2a · 2b · 2c · 2d ^ 3 ^ 4 ^ 5 ^ 6 ^ 7 ^ 8 ^ 9 ^ 10 ^ 11a · 11b ^ 12 ^ 13 ^ 14 ^ 15 ^ 16 ^ 17 ^ 18a · 18b ^ 19 ^ 20
    SP1:        -     -     -     -     -                                               -                                                     -               
    SP2:                                -                                               -                                                     -               
    SP3:                          -                                                                                                                           
    SP4:                          -     -                                                                                                                     
    SP5:                                                                                                                                                      


    ECgene alternative splicing isoforms for CPSF3

    Expression
    for CPSF3 gene

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    CPSF3 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS
    CGAP TAG: CTCCAGGACA

    Microarray
    RNAseq (Illumina Body Map)
    (100×FPKM)½
    SAGE (Serial Analysis of Gene Expression)
    About this image

    CPSF3 expression in embryonic tissues and stem cells
    Expression by the Database of Embryonic development, Stem cell research, and Regenerative medicine    About this table
    1 LifeMap In Vivo Development Anatomical Compartment/Cell 
    Tissue Anatomical Compartment CellCategory (developmental path)
    BoneMaxillary ProcessBone
    Expression: Positive    Negative     Selective marker
    Experimental details: Curated     Microarrays     In-situ hybridization

    See CPSF3 Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for CPSF3

    SOURCE GeneReport for Unigene cluster: Hs.515972
        SABiosciences Custom PCR Arrays for CPSF3
    Primer
    Products:    		 OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for CPSF3
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat CPSF3
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat CPSF3
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat CPSF3
    In Situ
    Assay Products:     
         		Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for CPSF3

    Orthologs
    for CPSF3 gene

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section
    This gene was present in the common ancestor of eukaryotes.

    Orthologs for CPSF3 gene from 9/36 species (see all 36)    About this table
    Organism Taxonomic
    classification    		 Gene Description Human
    Similarity    		 Orthology
    Type    		 Details
    chicken
    (Gallus gallus)    		 Aves CPSF31 cleavage and polyadenylation specific factor 3, 73kDa 82.86(n)
    95.05(a)    		   421929  XM_419942.3  XP_419942.3 
    lizard
    (Anolis carolinensis)    		 Reptilia CPSF36
    		 --
    		 93(a)
    		 1 ↔ 1
    		 1(148476380-148492469)
    African clawed frog
    (Xenopus laevis)    		 Amphibia Xl.160762 Xenopus laevis transcribed sequence with strong similarity more 83.56(n)    BJ031316.1 
    zebrafish
    (Danio rerio)    		 Actinopterygii wufc32f102 Transcribed sequence with strong similarity to protein more 80.58(n)    57048855 
    fruit fly
    (Drosophila melanogaster)    		 Insecta CG76983
    Cpsf731    		 mRNA cleavage3
    Cleavage and polyadenylation specificity factor 731    		 65(a)
    (best of 2)3
    62.58(n)1
    68.31(a)1    		   91B83
    422401  NM_142481.21  NP_650738.11 
    worm
    (Caenorhabditis elegans)    		 Secernentea Y67H2A.13
    cpsf-31    		 Protein CPSF-31 58(a)
    (best of 2)3
    61.56(n)1
    61.24(a)1    		   IV(13274276-13283038)3
    1782851  NM_070152.41  NP_502553.21 
    baker's yeast
    (Saccharomyces cerevisiae)    		 Saccharomycetes YSH1(YLR277C)4
    YSH11    		 Putative endoribonuclease, subunit of the mRNA cleavage more4
    Ysh1p1    		 55.89(n)1
    46.94(a)1    		   12(699495-697156)4
    8509831, 4  NP_013379.11, 4 
    thale cress
    (Arabidopsis thaliana)    		 eudicotyledons CPSF73-I1 cleavage and polyadenylation specificity factor subunit more 57.26(n)
    56.26(a)    		   842393  NM_001036138.1  NP_001031215.1 
    rice
    (Oryza sativa)    		 Liliopsida Os.90482 Oryza sativa (japonica cultivar-group) cDNA cloneJ more 71.45(n)    AK100660.1 


    ENSEMBL Gene Tree for CPSF3 (if available)
    TreeFam Gene Tree for CPSF3 (if available) 

    Paralogs
    for CPSF3 gene

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
    Paralogs for CPSF3 gene
    CPSF22  CPSF3L2  
    1 SIMAP similar gene for CPSF3 using alignment to 4 protein entries:     CPSF3_HUMAN (see all proteins):
    CPSF3L

    CPSF3 for paralogs           About GeneDecksing



    Genomic Variants
    for CPSF3 gene

    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/845 NCBI SNPs in CPSF3 are shown (see all 845)     About this table
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance    		Chr 2 posSequence#AA
    Chg    		TypeMore#Allele
    freq    		PopTotal
    sample    		More
    ----------
    rs1493792241,2
    		--9565660(+) AGTATA/GCAAAT 1 -- int10--------
    rs1463516571,2
    		--9565684(+) TTTTGG/TGGCTG 1 -- int10--------
    rs1397154621,2
    		--9565712(+) GGGTGG/TTTGTG 1 -- int10--------
    rs1429817451,2
    		--9565736(+) GGGCAG/TAGAGG 1 -- int10--------
    rs767601401,2
    		C,F,--9565853(+) GTTTCG/ATAACA 1 -- int11Minor allele frequency- A:0.08WA 118
    rs1460409841,2
    		C,--9565876(+) TACAG-/TTTACATACC
    ATACAACTCACAA    TTTAC     		1 -- int10--------
    rs611975721,2
    		C--9565896(+) ACTCA-/CAATTTACAT
    ACCATACAACTCA    TTTAA     		1 -- int11Minor allele frequency- CAATTTACATACCATACAACTCA:0.00NA 2
    rs621188501,2
    		--9565898(+) TCACAG/ATTTAC 1 -- int11Minor allele frequency- A:0.00NA 2
    rs1461513221,2
    		--9565955(+) TAGAGG/TTATAC 1 -- int10--------
    rs1488105141,2
    		--9566004(+) CTCCCA/GAGAGA 1 -- int10--------

    HapMap Linkage Disequilibrium report for CPSF3 (9563697 - 9613230 bp)
    Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
          Database of Genomic Variants (DGV) variations for CPSF3: --

    SABiosciences Cancer Mutation PCR Assays
    QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing CPSF3
    DNA2.0 Custom Variant and Variant Library Synthesis for CPSF3

    Disorders / Diseases
    for CPSF3 gene

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Novoseek, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section
    CPSF3 for disorders           About GeneDecksing

    OMIM gene information: 606029    OMIM disorders: --

    4 diseases for CPSF3:    About MalaCards
    pneumonia    influenza    immunodeficiency    malaria

    1 disease from the University of Copenhagen DISEASES database for CPSF3:
    Influenza

    2 Novoseek disease relationships for CPSF3 gene    About this table

    Disease   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    equine infectious anemia 61.8 1 8756653 (1)
    immunodeficiency 9.79 2 8756653 (2)


    Export disorders for CPSF3 gene to outside databases

    Publications
    for CPSF3 gene

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for CPSF3 gene, integrated from 9 sources (see all 82):
    (articles sorted by number of sources associating them with CPSF3)    		    Utopia: connect your pdf to the dynamic
    world of online information

    1. Polyadenylation factor CPSF-73 is the pre-mRNA 3'-end-processing endonuclease. (PubMed id 17128255)1, 2, 9 Mandel C.R.... Tong L. (2006)
    2. Human Fip1 is a subunit of CPSF that binds to U-rich RNA elements and stimulates poly(A) polymerase. (PubMed id 14749727)1, 2, 9 Kaufmann I.... Keller W. (2004)
    3. Conserved motifs in both CPSF73 and CPSF100 are required to assemble the active endonuclease for histone mRNA 3'-end maturation. (PubMed id 18688255)1, 2, 9 Kolev N.G.... Steitz J.A. (2008)
    4. The poly A polymerase Star-PAP controls 3'-end cleavage by promoting CPSF interaction and specificity toward the pre-mRNA. (PubMed id 21102410)1, 2 Laishram R.S. and Anderson R.A. (2010)
    5. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S....Malek J. (2004)
    6. Sequence similarity between the 73-kilodalton protein of mammalian CPSF and a subunit of yeast polyadenylation factor I. (PubMed id 8929409)1, 3 Jenny A....Keller W. (1996)
    7. The 160-kD subunit of human cleavage-polyadenylation specificity factor coordinates pre-mRNA 3'-end formation. (PubMed id 7590244)1, 9 Murthy K.G. and Manley J.L. (1995)
    8. Characterization of cleavage and polyadenylation specificity factor and cloning of its 100-kilodalton subunit. (PubMed id 7969155)1, 9 Jenny A....Keller W. (1994)
    9. The tumor suppressor Cdc73 functionally associates with CPSF and CstF 3' mRNA processing factors. (PubMed id 19136632)1, 9 Rozenblatt-Rosen O....Meyerson M. (2009)
    10. Transcription factor TFIID recruits factor CPSF for formation of 3' end of mRNA. (PubMed id 9311784)1, 9 Dantonel J.C....Tora L. (1997)

    External Searches for CPSF3 gene

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Disorders
    Free Text  
      Query String
    		PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    Genome Databases showing CPSF3 gene

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 51692 HGNC: 2326 AceView: CPSF3 Ensembl:ENSG00000119203 euGenes: HUgn51692
    ECgene: CPSF3 Kegg: 51692 H-InvDB: CPSF3

    Other Databases showing CPSF3 gene

    (According to HUGE)
    About This Section
    		   --

    Specialized Databases showing CPSF3 gene

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for CPSF3 Pharmacogenomics, SNPs, Pathways

    Intellectual Property
    for CPSF3 gene

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    		Patent Information for CPSF3 gene:
    Search GeneIP for patents involving CPSF3

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    Products
    for CPSF3 gene

    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences),
    In Situ Hybridization Assays from
    Advanced Cell Diagnostics
    About This Section

     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Phosphatase Activity Assays/Reagents   Browse Recombinant/Natural Proteins  
     OriGene Antibodies for CPSF3   OriGene shRNA RFP for CPSF3  
     OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for CPSF3   OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for CPSF3  
     OriGene Protein Over-expression Lysate for CPSF3   Browse OriGene Fluorogenic Cell Assay Kits  
     OriGene siRNA for CPSF3   OriGene 3'-UTR Clone for CPSF3  
     OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for CPSF3   OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for CPSF3  
     Browse OriGene GFP tagged cDNA clones in CMV expression vector   Browse OriGene MicroRNA Expression Plasmids  
     Browse OriGene basic RS shRNAs   Browse OriGene validated miRNA SYBR primer pairs  
     OriGene Purified Protein for CPSF3   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for CPSF3   OriGene Custom Protein Services for CPSF3  
     OriGene Custom Immunoassay Development  

         		 
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat CPSF3
     QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing CPSF3
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat CPSF3
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat CPSF3
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat CPSF3
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat CPSF3
     GenScript Custom Purified and Recombinant Proteins Services for CPSF3 GenScript cDNA clones with any tag delivered in your preferred vector for CPSF3
     GenScript Custom Assay Services for CPSF3 GenScript Custom Superior Antibodies Services for CPSF3
     GenScript Custom overexpressing Cell Line Services for CPSF3 CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in CPSF3 promoter
     Search Chromatin IP Primers for CPSF3
     RT2 qPCR Primer Assay in human, mouse, rat CPSF3
     GNC Network for CPSF3
     SABiosciences Custom PCR Arrays for CPSF3
     Search Tocris compounds for CPSF3
     Browse Sino Biological Proteins and Antibodies
     cDNA Clones for CPSF3
     Antibodies/Proteins Production Services
     Rabbit Monoclonal Antibody Platform
     Bulk Purchasing
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     CPSF3 antibodies
     CPSF3 proteins
     CPSF3 lysates
     Antibodies for CPSF3
     See all of Abcam's Antibodies, Kits and Proteins for CPSF3
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     CPSF3 Proteins, Antibodies, CLIAs, and ELISAs
     Search LifeMap BioReagents cell lines for CPSF3
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for CPSF3
     Browse SwitchGear 3'UTR luciferase reporter plasmids for CPSF3
     SwitchGear Promoter luciferase reporter plasmids for CPSF3
     Search ThermoFisher Antibodies for CPSF3
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat CPSF3
           
    GeneCards Homepage - Last full update: 19 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 26 Apr 2013

    View Random Gene

    Category
    VWF
    (GIFTS: 73)
    von Willebrand factor
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 

    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Copyright © 1996-2013 , Weizmann Institute of Science. All Rights Reserved.
    Hot genes      Disease genes      CPSF3 gene at Home site.
    hostname: 356977-web1.xennexinc.com index build: 100 solr: 1.4