Home
GeneCards Guide
Suite
- MalaCards
- GeneALaCart
- GeneDecks
- GeneIP
- GeneLoc
Terms and Conditions
- Terms of Use
- 3rd Party Notice
About Us
User Feedback
Mirror sites

Set Analyses:

Generates a file of GeneCards annotations for your list of genes

Advanced Search

Search By

Section (entire)

for

All GeneCards Within gene subset (to enable gene prioritization):
or upload a file of gene symbols

Category Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21

GIFtS
-

AADACL2 Gene

protein-coding GIFtS: 45
GCID: GC03P151451

arylacetamide deacetylase-like 2

Explore 4 diseases affiliated with
AADACL2 via

MalaCards

our new
Human Malady Compendium

(According to ¹HGNC, ²Entrez Gene,
³UniProtKB/Swiss-Prot, ⁴UniProtKB/TrEMBL, ⁵OMIM, ⁶GeneLoc, ⁷Ensembl, ⁸DME, ⁹miRBase, and/or ¹⁰fRNAdb)
About This Section

Aliases
Arylacetamide Deacetylase-Like 2¹ ²
MGC72001¹
EC 3.1.1.-³

External Ids:	HGNC: 24427¹	Entrez Gene: 344752²	Ensembl: ENSG00000197953⁷	UniProtKB: Q6P093³

Export aliases for AADACL2 gene to outside databases

Previous GC identifers: GC03P152936 GC03P148843

(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section

RefSeq DNA sequence:

NC_000003.11 NC_018914.1 NT_005612.16

Regulatory elements:

SABiosciences Regulatory transcription factor binding sites in the AADACL2 gene promoter:
Brachyury FOXD1 Cdc5 MEF-2A FOXC1 FOXO4 FOXO1a aMEF-2 FOXO1
Other transcription factors

SwitchGear Promoter luciferase reporter plasmid: AADACL2 promoter sequence

Search SABiosciences Chromatin IP Primers for AADACL2

Epigenetics:

QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat AADACL2

Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 3q25.1 Ensembl cytogenetic band: 3q25.1 HGNC cytogenetic band: 3q25.1

AADACL2 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
AADACL2 gene location

GeneLoc information about chromosome 3 GeneLoc Exon Structure

GeneLoc location for GC03P151451: view genomic region (about GC identifiers)

Start:	151,451,704 bp from pter	End:	151,479,127 bp from pter
Size:	27,424 bases	Orientation:	plus strand

1 alternative location:

Chr3+,PATCHES 151,456,973-151,480,825

(According to ¹UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to ²PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/Swiss-Prot: ADCL2_HUMAN, Q6P093 (See protein sequence)

Recommended Name: Arylacetamide deacetylase-like 2 precursor

Size: 401 amino acids; 46099 Da

Subcellular location: Secreted

Sequence caution: Sequence=AAH65724.1; Type=Erroneous initiation; Sequence=CAI46075.1; Type=Miscellaneous discrepancy;

Note=Wrong choice of CDS;

Secondary accessions: Q5HYJ4

Alternative splicing: 2 isoforms: Q6P093-1 Q6P093-3 (No experimental confirmation available. May be produced at very low levels due to a premature stop codon in the mRNA, leading to nonsense-mediated mRNA decay)

Explore the universe of human proteins at neXtProt for AADACL2: NX_Q6P093

Post-translational modifications:

View modification sites using PhosphoSitePlus²

View neXtProt modification sites for NX_Q6P093

AADACL2 Protein expression data from MOPED and PaxDb: About this image

REFSEQ proteins: NP_997248.2

ENSEMBL proteins:

ENSP00000387390 ENSP00000348911

Human Recombinant Protein Products:

	Browse Purified and Recombinant Proteins at EMD Millipore
	Browse R&D Systems for human recombinant proteins
	Browse recombinant and purified proteins available from Enzo Life Sciences
	OriGene Purified Protein: AADACL2 OriGene Protein Over-expression Lysate: AADACL2 OriGene Custom Protein Services for AADACL2
	GenScript Custom Purified and Recombinant Proteins Services for AADACL2
	Novus Biologicals AADACL2 Protein Novus Biologicals AADACL2 Lysates
	Browse Sino Biological Recombinant Proteins
	Browse ProSpec Recombinant Proteins
	Uscn Proteins for AADACL2

Gene Ontology (GO): 2 cellular component terms (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0005576	extracellular region	IEA	--
GO:0016021	integral to membrane	IEA	--

AADACL2 for ontologies About GeneDecksing

AADACL2 Antibody Products:

	Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
	Browse R&D Systems for Antibodies
	Browse OriGene Antibodies OriGene Custom Antibody Services for AADACL2
	GenScript Custom Superior Antibodies Services for AADACL2
	Novus Biologicals AADACL2 Antibody
	Search for Antibodies for AADACL2 at Abcam
	Uscn Antibodies for AADACL2
	Search ThermoFisher Antibodies for AADACL2

Assay Products for AADACL2:

	Browse Kits and Assays available from EMD Millipore
	OriGene Custom Immunoassay Development Browse OriGene Fluorogenic Cell Assay Kits
	Browse R&D Systems for biochemical assays
	GenScript Custom Assay Services for AADACL2
	Browse Enzo Life Sciences for kits & assays
	Uscn ELISAs and CLIAs for AADACL2

(According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
About This Section

AADACL2 for domains About GeneDecksing

3 InterPro domains/families:

IPR017157 Arylacetamide_deacetylase

IPR013094 AB_hydrolase_3

IPR002168 Lipase_GDXG_AS

Graphical View of Domain Structure for InterPro Entry Q6P093

ProtoNet protein and cluster: Q6P093

2 Blocks protein families:

IPB002168 Lipolytic enzyme

IPB013094 Alpha/beta hydrolase fold-3

UniProtKB/Swiss-Prot: ADCL2_HUMAN, Q6P093

Similarity: Belongs to the 'GDXG' lipolytic enzyme family

(According to ¹UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or ²DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013,
bound targets from SABiosciences, miRNA Gene Targets from miRTarBase shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
About This Section

Enzyme Number (IUBMB): EC 3.1.1.-¹

miRNA Products:		Browse 3'-UTR reporter clones for miRNA target validation Browse MicroRNA Expression Plasmids
		QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat AADACL2
		Search QIAGEN for miScript miRNA Assays for microRNAs that regulate AADACL2
		SwitchGear 3'UTR luciferase reporter plasmid: AADACL2 3' UTR sequence

Inhib. RNA Products:		Browse for Gene Knock-down Tools from EMD Millipore
		OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for AADACL2 (see all 4) OriGene shRNA RFP: AADACL2 OriGene siRNA: AADACL2
		QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat AADACL2

Gene Editing
Products:

DNA2.0 Custom Protein Engineering Service for AADACL2

Clone Products:		Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
		OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for AADACL2 (see all 3) OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for AADACL2 (see all 3) OriGene custom cloning services � gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector: AADACL2 (NM_207365)
		Browse Sino Biological Human cDNA Clones
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for AADACL2
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat AADACL2

Cell Line Products:		GenScript Custom overexpressing Cell Line Services for AADACL2
		Search LifeMap BioReagents cell lines for AADACL2

In Situ Assay
Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for AADACL2

Gene Ontology (GO): 1 molecular function term (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0004091	carboxylesterase activity	IEA	--

AADACL2 for ontologies About GeneDecksing

1 GenomeRNAi human phenotype for AADACL2:

Decreased POU5F1-GFP protein e

(Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to ¹UniProtKB, ²MINT, ³I2D, and/or ⁴STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
About This Section

Interactions:

Search SABiosciences Gene Network Central^TM Interacting Genes and Proteins Networks for AADACL2

(Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
About This Section

Browse Small Molecules at EMD Millipore

Browse drugs & compounds from Enzo Life Sciences

Browse Tocris compounds for AADACL2

2 DrugBank Compounds for AADACL2 About this table

Compound	Synonyms	CAS #	Type	Actions	PubMed Ids
GIBBERELLIN A3	--	--	target	--	10592235
GIBBERELLIN A4	--	--	target	--	10592235

Search CenterWatch for drugs/clinical trials and news about AADACL2 / ADCL2

(Secondary structures according to fRNAdb,
GenBank/EMBL/DDBJ Accessions according to
Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
RefSeq according to Entrez Gene,
DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
RNAi Products from EMD Millipore,
siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
About This Section

REFSEQ mRNAs for AADACL2 gene:

NM_207365.3

Unigene Cluster for AADACL2:

Arylacetamide deacetylase-like 2

Hs.144710 [show with all ESTs]

Unigene Representative Sequence: BX647585

2 Ensembl transcripts including schematic representations, and UCSC links where relevant:

ENST00000445270(uc010hvn.3) ENST00000356517(uc003ezc.3)

miRNA Products:		Browse 3'-UTR reporter clones for miRNA target validation Browse OriGene MicroRNA Expression Plasmids
		QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat AADACL2
		Search QIAGEN for miScript miRNA Assays for microRNAs that regulate AADACL2
		SwitchGear 3'UTR luciferase reporter plasmid: AADACL2 3' UTR sequence

Inhib. RNA Products:		Browse for Gene Knock-down Tools from EMD Millipore
		OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for AADACL2 (see all 4) OriGene shRNA RFP: AADACL2 OriGene siRNA: AADACL2
		QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat AADACL2

Clone Products:		OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for AADACL2 (see all 3) OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for AADACL2 (see all 3) OriGene custom cloning services � gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector: AADACL2 (NM_207365)
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for AADACL2
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat AADACL2

Primer Products:		OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for AADACL2 Browse OriGene validated miRNA SYBR primer pairs
		SABiosciences RT² qPCR Primer Assay in human, mouse, rat AADACL2
		QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat AADACL2
		QIAGEN QuantiFast Probe-based Assays in human, mouse, rat AADACL2

Additional cDNA sequence:

BC065724.1 BX647585.1

2 DOTS entries:

DT.210964 DT.99979342

17 AceView cDNA sequences:

AI130823 BX647585 NM_207365 BC065724 AA045911 BX118873 AI122615 AA027036

AL599128 AA045966 AA122299 AA122302 AA045778 CB851186 AA122269 AA045832

AA027115

GeneLoc Exon Structure

(RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
About This Section

AADACL2 expression in normal human tissues (normalized intensities)
See probesets specificity/sensitivity at GeneAnnot
About this imageBioGPS
CGAP TAG: ACTTCACCAT

About this image
See AADACL2 Protein Expression from SPIRE MOPED and PaxDB
Genevestigator expression for AADACL2

SOURCE GeneReport for Unigene cluster: Hs.144710

SABiosciences Custom PCR Arrays for AADACL2

Primer Products:		OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for AADACL2 Browse OriGene validated miRNA SYBR primer pairs
		SABiosciences RT² qPCR Primer Assay in human, mouse, rat AADACL2
		QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat AADACL2
		QIAGEN QuantiFast Probe-based Assays in human, mouse, rat AADACL2

In Situ
Assay Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for AADACL2

(Orthologs according to ^1,2HomoloGene (²older version, for species not in ¹newer version), ³euGenes, ⁴SGD , ⁵MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or ⁶Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
About This Section

This gene was present in the last universal common ancestor (LUCA).

Orthologs for AADACL2 gene from 5/16 species (see all 16) About this table

Organism	Taxonomic classification	Gene	Description	Human Similarity	Orthology Type	Details
chicken (Gallus gallus)	Aves	AADAC⁶	Uncharacterized protein	47(a)	1 → many	9(25019110-25024050)
lizard (Anolis carolinensis)	Reptilia	--	--	49(a)	1 → many	3(17852058-17873020)
zebrafish (Danio rerio)	Actinopterygii	BX000999.4⁶	--	43(a)	1 → many	15(1040924-1061924)
worm (Caenorhabditis elegans)	Secernentea	Y43F8A.3⁶ trcs-1⁶ (see all 4)	Protein TRCS-1 (see all 4)	25(a) 22(a) (see all 4)	many ↔ many many ↔ many (see all 4)	V(19377415-19381002) IV(9587081-9588817)
E. coli (Escherichia coli)	Gamma proteobacteria	aes⁶	acetyl esterase	19(a)	possible ortholog	Chromosome(498238-499197)

ENSEMBL Gene Tree for AADACL2 (if available)
TreeFam Gene Tree for AADACL2 (if available)

(Paralogs according to ¹HomoloGene,
²Ensembl, and ³SIMAP, Pseudogenes according to ⁴Pseudogene.org Build 68)
About This Section

Paralogs for AADACL2 gene

AADAC² AADACL4² LIPE² AADACL3² NCEH1²

3 SIMAP similar genes for AADACL2 using alignment to 2 protein entries: ADCL2_HUMAN (see all proteins):

AADAC NCEH1 AADACL3

AADACL2 for paralogs About GeneDecksing

(SNPs/Variants according to the ¹NCBI SNP Database, ²Ensembl, ³PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
About This Section

SNP ID	Valid	Clinical significance	Chr 3 pos	Sequence	#	AA Chg	Type	More	#	Allele freq	Pop	Total sample	More
Genomic Data					Transcription Related Data				Allele Frequencies
				--	--	--		--	--
rs145669840^1,2		--	151449726(+)	`ACAGG-/AGAT AGATA`	1	--	us2k¹		0	--	--	--	--
rs2009669^1,2	C,F,A,	--	151449796(-)	`TATAGA/GTATAT`	1	--	us2k¹		4		WA NA	242
rs200377114^1,2		--	151450182(+)	`ATATG-/CATA TGTGT`	1	--	us2k¹		0	--	--	--	--
rs1584387^1,2	C,H	--	151450183(-)	`ACATAT/CGCATA`	1	--	us2k¹		1		NA	2
rs58358506^1,2	C,	--	151450183(+)	`TATGC-/ATAT GTGTG`	1	--	us2k¹		1		CSA	2
rs1584386^1,2	C,H	--	151450185(-)	`ACACAT/CATGCA`	1	--	us2k¹		1		NA	2
rs2410879^1,2		--	151450205(-)	`atacaC/Tacaca`	1	--	us2k¹		0	--	--	--	--
rs200866755^1,2		--	151450205(+)	`GTGTG-/TATGTAT`	1	--	us2k¹		0	--	--	--	--
rs2410878^1,2	C,	--	151450207(-)	`ATATAC/TACACA`	1	--	us2k¹		1		NA	2
rs144097991^1,2		--	151450385(+)	`TTTCA-/GAGTCTAAGGGCATAGGAACT AGGAGCTCTGATATCCAAGGGCAGGAGTC`	1	--	us2k¹		0	--	--	--	--

HapMap Linkage Disequilibrium report for AADACL2 (151451704 - 151479127 bp)
Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
Database of Genomic Variants (DGV): 1 variation for AADACL2
1 CNV: 3457
Human Gene Mutation Database (HGMD): AADACL2

SABiosciences Cancer Mutation PCR Assays

QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing AADACL2

DNA2.0 Custom Variant and Variant Library Synthesis for AADACL2

(in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
About This Section

AADACL2 for disorders About GeneDecksing

4 diseases for AADACL2: About MalaCards

hermaphroditism infertility tuberculosis mycobacterium tuberculosis

Export disorders for AADACL2 gene to outside databases

(in PubMed. Associations of this gene to articles via ¹Entrez Gene, ²UniProtKB/Swiss-Prot, ³HGNC, ⁴GAD, ⁵PharmGKB, ⁶HMDB, ⁷DrugBank, ⁸UniProtKB/TrEMBL, ⁹ Novoseek, and/or ¹⁰fRNAdb)
About This Section

PubMed articles for AADACL2 gene integrated from 9 sources:
(articles sorted by number of sources associating them with AADACL2)

Utopia: connect your pdf to the dynamic
world of online information

Large-scale identification of human genes implicated in epidermal barrier function. (PubMed id 17562024)¹ Toulza E.... Guerrin M. (2007)
hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes. (PubMed id 17207965)¹ Lamesch P.... Vidal M. (2007)
The full-ORF clone resource of the German cDNA consortium. (PubMed id 17974005)² Bechtel S.... Schupp I. (2007)
The DNA sequence, annotation and analysis of human chromosome 3. (PubMed id 16641997)² Muzny D.M....Gibbs R.A. (2006)
The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)² Gerhard D.S....Malek J. (2004)
Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PubMed id 12477932)¹ Strausberg R.L....Marra M.A. (2002)
The Protein Data Bank. (PubMed id 10592235)⁷ Berman H.M....Bourne P.E. (2000)

(in PubMed, OMIM, and NCBI Bookshelf)
About This Section

		AND	OR
Aliases
Free Text

Query String		PubMed OMIM NCBI Bookshelf
	(Note: In FireFox, select the above section and copy using Ctrl-C)

(According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
About This Section

Entrez Gene: 344752	HGNC: 24427	AceView: MGC72001	Ensembl:ENSG00000197953	euGenes: HUgn344752
ECgene: AADACL2	H-InvDB: AADACL2

(According to HUGE)
About This Section

(According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
About This Section

Name	Description
PharmGKB entry for AADACL2	Pharmacogenomics, SNPs, Pathways

Intellectual Property for AADACL2 gene
(Patent information from GeneIP, Licensable technologies from WIS Yeda, Salk, Tufts, IP news from LifeMap Sciences, Inc.)

About This Section

Patent Information for AADACL2 gene:
Search GeneIP for patents involving AADACL2

GeneCards and IP:
Japan Patent Office Licenses GeneCards European Patent Office Licenses GeneCards Improving the IP Search

(Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences),
In Situ Hybridization Assays from
Advanced Cell Diagnostics
About This Section


	EMD Millipore Custom Antibody & Bulk Services
	EMD Millipore Preclinical / Clinical Development Services
	EMD Millipore Immunoassay Services
	EMD Millipore Target Screening & Profiling Services

	Browse Antibodies		Browse Cell Culture Products
	Browse ELISAs		Browse Flow Cytometry Kits
	Browse Primer Pairs		Browse Kinase Activity Assays/Reagents
	Browse ELISpot Kits/Development Modules		Browse TFB/Immunoprecipitation Assays
	Browse Apoptosis Detection Kits/Reagents		Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents
	Browse DNA Damage/Repair Kits/Reagents		Browse Multiplex/Array Assay Kits/Reagents
	Browse Cell Selection/Detection Kits/Reagents		Browse Secondary Antibodies/Controls/Staining Reagents
	Browse Phosphatase Activity Assays/Reagents		Browse Recombinant/Natural Proteins

	Browse OriGene Antibodies		OriGene shRNA RFP for AADACL2
	OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for AADACL2		OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for AADACL2
	OriGene Protein Over-expression Lysate for AADACL2		Browse OriGene Fluorogenic Cell Assay Kits
	OriGene siRNA for AADACL2		Browse 3'-UTR reporter clones for miRNA target validation
	OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for AADACL2		OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for AADACL2
	Browse OriGene GFP tagged cDNA clones in CMV expression vector		Browse OriGene MicroRNA Expression Plasmids
	Browse OriGene basic RS shRNAs		Browse OriGene validated miRNA SYBR primer pairs
	OriGene Purified Protein for AADACL2		OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
	OriGene Custom Antibody Services for AADACL2		OriGene Custom Protein Services for AADACL2
	OriGene Custom Immunoassay Development

	QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat AADACL2
	QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing AADACL2
	QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat AADACL2
	QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat AADACL2
	QIAGEN QuantiFast Probe-based Assays in human, mouse, rat AADACL2
	QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat AADACL2

	GenScript Custom Purified and Recombinant Proteins Services for AADACL2		GenScript cDNA clones with any tag delivered in your preferred vector for AADACL2
	GenScript Custom Assay Services for AADACL2		GenScript Custom Superior Antibodies Services for AADACL2
	GenScript Custom overexpressing Cell Line Services for AADACL2		CloneReady with Over 120,000 Genes
	Gene Synthesis: Any Gene in Any Vector		Vector-based siRNA and miRNA, Ready for Transfection
	Gene Mutant Library, Variants up to 10^11		Plasmid Preparation
	Custom Peptide Services

Search for Antibodies & Assays

	Regulatory tfbs in AADACL2 promoter
	Search Chromatin IP Primers for AADACL2
	RT² qPCR Primer Assay in human, mouse, rat AADACL2
	Search GNC Networks for AADACL2
	SABiosciences Custom PCR Arrays for AADACL2

Search Tocris compounds for AADACL2

	Browse Sino Biological Proteins and Antibodies
	Browse Sino Biological cDNA Clones
	Antibodies/Proteins Production Services
	Rabbit Monoclonal Antibody Platform
	Bulk Purchasing

Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

	Novus Tissue Slides
	AADACL2 antibodies
	AADACL2 proteins
	AADACL2 lysates

	Search for Antibodies for AADACL2 at Abcam
	See all of Abcam's Antibodies, Kits and Proteins for AADACL2
	Custom Antibody / Protein Production Service
	Bulk Purchasing
	Advantages of Rabbit Monoclonal antibodies
	Abcam protocols and scientific support

Browse ProSpec Recombinant Proteins

AADACL2 Proteins, Antibodies, CLIAs, and ELISAs

Search LifeMap BioReagents cell lines for AADACL2

	Gene Synthesis
	Protein Engineering
	Variant Library Synthesis
	Codon Optimization
	Protein Production and Purification

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for AADACL2

	SwitchGear 3'UTR luciferase reporter plasmids for AADACL2
	SwitchGear Promoter luciferase reporter plasmids for AADACL2

Search ThermoFisher Antibodies for AADACL2

Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat AADACL2

GeneCards Homepage - Last full update: 18 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 26 Apr 2013

View Random Gene

Category			VWF (GIFTS: 73) von Willebrand factor
GIFtS Group

The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z

The GeneCards Human Gene Database

Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

Hot genes Disease genes AADACL2 gene at Home site.

hostname: 356977-web1.xennexinc.com index build: 100 solr: 1.4

Advanced Search

Export list of displayed genes

AADACL2 Gene

arylacetamide deacetylase-like 2

Aliases
for AADACL2 gene

Summaries
for AADACL2 gene

Genomic Views
for AADACL2 gene

Proteins
for AADACL2 gene

Protein Domains /
Families
for AADACL2 gene

Function
for AADACL2 gene

Pathways & Interactions
for AADACL2 gene

Drugs & Compounds
for AADACL2 gene

Transcripts
for AADACL2 gene

Expression
for AADACL2 gene

Orthologs
for AADACL2 gene

Paralogs
for AADACL2 gene

Genomic Variants
for AADACL2 gene

Disorders / Diseases
for AADACL2 gene

Publications
for AADACL2 gene

External Searches for AADACL2 gene

Genome Databases showing AADACL2 gene

Other Databases showing AADACL2 gene

Specialized Databases showing AADACL2 gene

Intellectual Property
for AADACL2 gene

Products
for AADACL2 gene

View Random Gene

Advanced Search

Export list of displayed genes

AADACL2 Gene

arylacetamide deacetylase-like 2

Aliasesfor AADACL2 gene

Summariesfor AADACL2 gene

Genomic Viewsfor AADACL2 gene

Proteinsfor AADACL2 gene

Protein Domains /Familiesfor AADACL2 gene

Functionfor AADACL2 gene

Pathways & Interactionsfor AADACL2 gene

Drugs & Compoundsfor AADACL2 gene

Transcriptsfor AADACL2 gene

Expression for AADACL2 gene

Orthologsfor AADACL2 gene

Paralogsfor AADACL2 gene

Genomic Variantsfor AADACL2 gene

Disorders / Diseasesfor AADACL2 gene

Publicationsfor AADACL2 gene

External Searches for AADACL2 gene

Genome Databases showing AADACL2 gene

Other Databases showing AADACL2 gene

Specialized Databases showing AADACL2 gene

Intellectual Propertyfor AADACL2 gene

Productsfor AADACL2 gene

View Random Gene

Aliases
for AADACL2 gene

Summaries
for AADACL2 gene

Genomic Views
for AADACL2 gene

Proteins
for AADACL2 gene

Protein Domains /
Families
for AADACL2 gene

Function
for AADACL2 gene

Pathways & Interactions
for AADACL2 gene

Drugs & Compounds
for AADACL2 gene

Transcripts
for AADACL2 gene

Expression
for AADACL2 gene

Orthologs
for AADACL2 gene

Paralogs
for AADACL2 gene

Genomic Variants
for AADACL2 gene

Disorders / Diseases
for AADACL2 gene

Publications
for AADACL2 gene

Intellectual Property
for AADACL2 gene

Products
for AADACL2 gene